Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ287309
Length 659 bp
Fasta Format > rwhr25i16
gcttctttancaaacctaatgaagcactgtagttactcttcacttatttc gcctgactgtattacaagatatgacgctattcatgataaaactacacaaa cgtccacaaattgacagctcggaacagacgcatcaatcattccttgggca cttacgaggtgattgaaaaaggtcacaaatgaaatacgggcccacaagtc accatggaaatacagtaatgtcaaaggaatagctgacagttgtggcctca ggttctaacagcatcctgatgatccttgaccccggttgccacccaccacg tccacggtgtccggcatatacagttcttcctctggctcgttcttcagagc gttctttactatacactggaaagcttcctccacgttgattccatccttgg cagaagtctcaaagtatgggatgttccctttagaggcacaccatgccttc gcctttttctcagaaaccacgcgactattcccgccatctacatcaacttt gttacccagcagaacaaaagggaagttatcaggatctgatgggctagcct gaattagaaactcttcacgccagttgttcagattatcaaatgatttcatt gagttaacatcgtaaactagaacacaacaatctgcacccgcggtagaatg caacaccaa
Download
page-top