Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ286908
Length 739 bp
Fasta Format > rwhr23m16
ggtctngaatagcacttaataaggtaaacatcccattacatctagcagca acccgagttcgcaaatcaacaaacatcaggcaaaacttaaaaacgacggt tccaggaacataggtctatatccttgaagataactggctatagcaaaacg actcaacgcctcagaatcaggccttggcagcagcctgggcagcggcatcc cgcttcctctgctcctcaatgatggtgagcttgatacccttgcccttggg gaggctcacccacggcttggtgcccttgccgatggtgaacacgttgccca gacgggtggcaaactggtggccctgcgcatcctcaacgtggatggtctcg aaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagt gttgcgcccaccagtaaccatgaccacattgccgacgtcaaacttgatga agtcaacaatcttgttggtctccaggtcgagcttgatggtgtcattggcc ttgatgagtgggtctgggtagcggatggtgcggccatcataggtgttcag gtaggggatgcccttctggccgaactggacagacctgaccttgcagagct tgaacttagcatcctcatccctgacagagtgaaggcggaagcgacccttg gtgtcataaagaagcctgtagttctcaccagtcttgggaatggaaatgat gtccatgaacccagcaggggtaggtcttggtcagtgcgg
Download
page-top