Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxd_38013_d02f
Length 620 bp
Fasta Format > whxd_38013_d02f
TGTTCTCACCCTCCCTCCGTCCGTCGCAGCTCCAGATTTCCTTCCCCATG GCTCCGATCAAGATCGGCATCAATGGTTTCGGCCGGATCGGCAGGCTTGT GGCCAGGGTTGCGCTCCAGAGCCCCGATGTCGAGCTCGTCGCCGTTAACG ACCCCTTCATCACCACCGACTACATGACCTACATGTTCAAGTATGACACT GTCCACGGACAGTGGAAGCACCATGAAGTTAAGGTGAAGGACTCCAAGAC CCTTCTCTTCGGTGAGAAGGAGGTTGCGGTGTTTGGCTGCAGGAACCCAG AGGAGATCCCATGGGCTGCTGCTGGTGCTGAGTACGTTGTTGAGTCCACC GGTGTTTTCACTGACAAGGACAAGGCTGCAGCTCACATTAAGGGTGGTGC CAAGAAGGTCATCATTTCTGCTCCCAGCAAGGATGCTCCCATGTTTGTCT GTGGTGTCAATGAGAAGGAATACAAGTCTGACATCGACATTGTCTCCAAC GCTAGCTGCACCACTAACTGCCTTGCTCCTCTTGCTAAGGTTATCAATGA CAGGTTTGGCATTGTTGANNGTTTGATGACCACAGTTCATGCCATGACTG CAACCCAGAAGACTGTTGAT
Download
page-top