Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ286722
Length 650 bp
Fasta Format > rwhr23a07
ggtctcgaaatagcacttaataaggtaaacatcccattacatctagcagc aaccacgagttcgcaaatcaacaaacatcaggcaaaacttaaaaacgacg gttccaggaacataggtctatatccttgaagataactggctatagcaaaa cgactcaacgcctcagaatcaggccttggcagcagcctgggcagcggcat cccgcttcctctgctcctcaatgatggtgagcttgatacccttgcccttg gggaggctcacccacggcttggtgcccttgccgatggtgaacacgttgcc cagacgggtggcaaactggtggccctgcgcatcctcaacgtggatggtct cgaaggttcccttatgcttctccctgttcttgatcacaccaacacgccca gtgttgcgcccaccagtaaccatgaccacattgccgacgtcaaacttgat gaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcattgg ccttgatgagtgggtctgggtagcggatggtgcggccatcataggtgttc aggtaggggatgcccttctggccgaactggacagacctgaccttgcagag cttgaacttagcatcctcatccctgacagagtgaaggcggaagcgaccct
Download
page-top