Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ286546
Length 680 bp
Fasta Format > rwhr22d02
cttatttatncntnatacgacaaaaggttcacaccacaattcatgcaccc ttgcttgcaccagaacacgcacataacacccacacacacaagccaggcaa gggacagtccacgcagagtgcacgcttgcgacaaccagagcacatcaagg ctcgaattattccaacctagacagggcctactgctgcccatcactaccga cacaatgggggtgggtcgggtctccaagcggcgggagggcttacgggttc actttcggcgcccacccggcgatcaggttctccttggtcgccttggtctt gacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctgg tcagggtttcagggaccttccagcccttgaagtgctccagggcgacctgg aggtggtagagcttcggagccaggctgagatcgacggcggagatgttcgc cccgttgatgtagggtccatgggccttcaggtgctcttcgagtgcctgca gctcgtcaacaagtgccttctccgaaccatcgctggcatccttgctcttc aagaacgtgacgaaggtggagaagatctttgatcccactgatgcatactc aggaggggtcacaagtgatggagttgggtacttctcctcaatgactttga gtgatcacatcagaatcagcaatccatttg
Download
page-top