Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ286325
Length 557 bp
Fasta Format > rwhr21e02
tacaacacaacaggttgtaaaacaaacaccacaaagcaaacgttcaaaca gacagataacagataaagccactcgggcagatcatangatagcagtagca agccttgggaaagcaccaggaggcaggcttaatactcatcgccctcatca ccgtcctcaccctcgtcgaactcagcaccaacttcttcatagtccttctc cagggcagcgagatcctcacgggcctcagagaactctccctcctccatgc cctcaccgacgtaccagtggacgaaggcacncttggcgtacatcaggtca aacttgtggtcgatgcgggagaagacctcgacgacactggtggagttgga gatcatgcacacagccctctggaccttggcaaggtcaccgcctgggacga cacctggtggctggtagttgataccacacttgaagccagtggggcaccag tcaacaaactgaatagtgcgcttggtcttgatggtggccacagcagcgtt gacgtnctttggcacaacatcaccacggtacatgagacagcaggccatgt acttgcc
Download
page-top