Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whxc_1054_l16f
Length 653 bp
Fasta Format > whxc_1054_l16f
CCCGAGCTCCTCGTCTCCGGCGGCGGAAGGAAGCAGCGGCAGCGGCAGCG GCAGCCATGGTGAAGGGACGCACTGGGCAGCGCGTCAGGCTCTACGTCCG GGGCACCATCCTCGGGTTCAAGAGGTCCAAGTCGAACCAGTACGAGAGCA CGTCGCTGGTGCAGGTCGAGGGGGTGAACACCAAGGAGGACGTGGCGTGG TACGCCGGGAAGCGCCTGGCGTATGTCTACAAGGCCAAGACCAAGAGCAA CGGCACCCACTACCGCTGCCTCTGGGGCAAGATCACCCGCCCGCACGGCA ACTCCGGCGTCGTCCGCGCCCAGTTCAAGTCCAACCTCCCCGCCGAGTCC ATGGGGCGCAAGGTCAGGGTGTTCATGTACCCGAGCAGCATCTAAGGTTT TTTTGATCTAGGGACAGTAATGCTTGTTTCTTGTGATTGTCATGAGCTGA GAAATGTCATTTTATGGTGAATCTATGCTATGTTGGCAACCGAAACTGAT CATGTATTCCGAGAACCTGTGGAAGTTTTGGCTAGACTTGTTTGTCAAAT GTGCGGACCATTTTAGTATATTTCTATATCAGCACTAAAGCGTAATTTGT CATGAGTTTGTGACTGTTTTGCAATGTTTGAGTGTTATATCAGAAAAAAA AAA
Download
page-top