Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ286097
Length 414 bp
Fasta Format > rwhr19e02
gcatgtcatattaaccaggtgcaaagtcaggttcaaagatacaaggttct tacaacacaacaggttgtaaaacaaacaccacaaagcaaacgttcaaaca gacagataacagataaagccactcgggcagatcataggatagcagtagca agccttgggaaagcaccaggaggcaggcttaatactcatcgccctcatca ccgtcctcaccctcgtcgaactcagcaccaacttcttcatagtccttctc cagggcagcgagatcctcacgggcctcagagaactctccctcctccatgc cctcaccgacgtaccagtggacgaaggcacgcttggcgtacatcaggtca aacttgtggtcgatgcgggagaagacctnnacgacactggttggagttgg agatnatgcacaca
Download
page-top