Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ283836
Length 696 bp
Fasta Format > rwhr17l20
tattaaccaggtgcaaagcaggttcaaagatacaaggttcttacaacaca acaggttgtaaaacaaacaccacaaagcaaacgttcaaacagacagataa cagataaagccactcgggcagatcataggatagcagtagcaagccttggg aaagcaccaggaggcaggcttaatactcatcgccctcatcaccgtcctca ccctcgtcgaactcagcaccaacttcttcatagtccttctccagggcagc gagatcctcacgggcctcagagaactctccctcctccatgccctcaccga cgtaccagtggacgaaggcacgcttggcgtacatcaggtcaaacttgtgg tcgatgcgggagaagacctcgacgacactggtggagttggagatcatgca cacagccctctggaccttggcaaggtcaccgcctgggacgacacctggtg gctggtagttgataccacacttgaagccagtggggcaccagtcaacaaac tgaatagtgcgcttggtcttgatggtggccacagcagcgttgacgtcctt tggcacaacatcaccacggtacatgagacagcaggccatgtacttgccgt ggcgggggtcgcacttggccatcatggacgaaggctcaaaggcgctgttg gtgatctcagcaacggacagctgctcatggtaagccttctcagctg
Download
page-top