Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ282928
Length 609 bp
Fasta Format > rwhr12n01
caggtgcaaagcaggttcaaagatacaaggttcttacaacacaacaggtt gtaaaacaaacaccacaaagcaaacgttcaaacagacagataacagataa agccactcgggcagatcataggatagcagtagcaagccttgggaaagcac caggaggcaggcttaatactcatcgccctcatcaccgtcctcaccctcgt cgaactcagcaccaacttcttcatagtccttctccagggcagcgagatcc tcacgggcctcagagaactctccctcctccatgccctcaccgacgtacca gtggacgaaggcacgcttggcgtacatcaggtcaaacttgtggtcgatgc gggagaagacctcgacgacactggtggagttggagatcatgcacacagcc ctctggaccttggcaaggtcaccgcctgggacgacacctggtggctggta gttgataccacacttgaagccagtggggcaccagtcaacaaactgaatag tgcgcttggtcttgatggtggccacagcagcgttgacgtcctttggcaca acatcaccacggtacatgagacagcaggccatgtacttgccgtggcgggg gtcgcactt
Download
page-top