Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208708
Length 516 bp
Fasta Format > wh10g22
acactggggcgccccccaaccctagccgtcacagacccccaccacaacca cgccttcgccgccggtggcggcgaaggcggctcctcaaagcagggacgcg tctcccgtcgaaatccaagtccgttcgcgcgagcttctccgcccctcgat ccgatcttcaccttcgctcatggtggccgtcagctggcctcccgccggcg gccaacttgatctgcgcggcactcggctgcccgcatggcctacctcctcc ccatcgcggcactcgttggccgccgttgggcctgcttgcggcgcacaggt cgggtcacgcgcgacggctacatcatcgccggatctgtctttccgtccga ctgcgaccccaaccccagcaccctcaatccaccgcccgcttcccccactc ccgcttgactccatggggccctaaggtcgatagcgccgaggaggagtcag agacggcactgggggaaagagcagcgaggccggaggcccagacggcgctc gcgttatgtgtctaac
Download
page-top