Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ279688
Length 427 bp
Fasta Format > whr4d09
gaggaattcggcacgaggacagacccctcccctcccctcccctcccccaa cccaccggcggcggcgcagcgcagcttgaggaaggaagcgaagatggtga agttcctgaagcccggcaaggcggtgatcctgctgcagggcaggtacgcg gggaagaaggcggtgatcgtgcgcgtgttcgaggagggcacccgcgaccg cccgtacgggcactgcctcgtcgccgggctggccaagtacccgaagaagg tgatccgcaaggactcggccaagaagacggccaagaagtcccgcgtcaag gtgttcctcaagctcgtcaacttcacccatctcatgcccacccgctatac cctcgacgtcgacctcaaggaggtggcctccggcgcgcccgactccctca cctccaaggacaagaaggtgggcgccg
Download
page-top