Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ282227
Length 608 bp
Fasta Format > whr25k24
ccggcatccaggtcgggaacgcgtgctgggagctctactgcctcgagcat ggcattcagcctgatggcctgatgcccggtgacaagaccgttgggggagg tgatgatgctttcaacaccttcttcagcgagactggtgctgggaagcatg tcccccgtgctgtctttgtagatctcgagcccactgtgattgatgaggtg aggactggtgcttaccgccagctcttccaccctgagcagcttatcagtgg caaggaggatgcagccaacaacttcgcccgtggtcattacaccattggca aggagattgttgatctgtgccttgaccgtatcaggaagctttcagacaac tgcactggtctccagggattccttgtattcaacgctgttggaggtggaac tggctctggccttggctcgcttctcctggagcgcctctctgttgactatg gaaagaagtccaagcttgggttcacggtgtacccatctccccaggtctcc acctctgttgttgagccatacaacagtgtcctgtccacccactcactcct tgagcacactgatgtctctatccttcttgacaatgaggccatctatgaca tctgccgc
Download
page-top