Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ282022
Length 599 bp
Fasta Format > whr24n04
tcggcacgaggctcctcgtctccgctcccacgcccgcgggnagagaggcg accggcggcggcgcgcgaggaggggcctacccacccatcccaccaccccg ccggcgaagatgttcggccgcgcccccaagaagagcgacaacaccaagta ctacgaggtgctcggggtgcccaagaacgccgcccaggacgacctcaaga aggcctaccgcaaggccgccatcaagaaccaccccgacaagggcggagac cccgagaagttcaaggagctggcacaagcctatgaggttttgagtgaccc tgagaagcgtgagatctatgatcagtatggcgaagatgctctcaaggaag gaatgggtggaggaggaggtggtgggaagtttgatccatttgacatcttc tcatcatttttcgggccctcttttggaggtggtggtggcggcagcagcag gggcagaaggcaaaggaggggagaggatgttgtccatccacttaaagctt ctctagaagatctttacaatggtacctcgaagaagctctctctttcccgt agtgtcctctgctccaagtgcaagggcaagggatccaagtctggtgctt
Download
page-top