Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ281408
Length 108 bp
Fasta Format > whr21o13
ggggtttgaagaagcatctgaagaggctnaatgccccgtctcactggatg cttgacaagcttggtggagcttttgcccccaagccatcatctgggcctca caaggcca
Download
page-top