Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ281233
Length 637 bp
Fasta Format > whr21b21
ttcggcacgaggcttcgtactcgcctctctccgcgcatcctagccttcgc cctcctccttccccatttcgccagcggcgcagcccaccaaccacccccac ccgccgccatgagggagtgcatctcgatccacatcggccaggccggcatc caggtcgggaacgcgtgctgggagctctactgcctcgagcatggcattca gcctgatggccagatgcccggtgacaagaccgttgggggaggtgatgatg ctttcaacaccttcttcagcgagactggtgctgggaagcatgtcccccgt gctgtctttgtagatctcgagcccactgtgattgatgaggtgaggactgg tgcttaccgccagctcttccaccctgagcagcttatcagtggcaaggagg atgcagccaacaacttcgcccgtggtcattacaccattggcaaggagatt gttgatctgtgccttgaccgtatcaggaagctttcagacaactgcactgg tctccagggattccttgtattcaacgctgttggaggtggaactggctctg gccttggctcgcttctcctggagcgcctctctgttgactatggaaagaag tccaagcttgggttcacggtgtacccatctccccagg
Download
page-top