Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ279076
Length 595 bp
Fasta Format > whr1b20
gcgtcttcgtactcgcctctctccgcgcatcctagccttcgccctcctcc ttccccatttcgccagcggcgcagcccaccaaccacccccacccgccgcc atgagggagtgcatctcgatccacatcggccaggccggcatccaggtcgg gaacgcgtgctgggagctctactgcctcgagcatggcattcagcctgatg gccagatgcccggtgacaagaccgttgggggaggtgatgatgctttcaac accttcttcagcgagactggtgctgggaagcatgtcccccgtgctgtctt tgtagatctcgagcccactgtgattgatgaggtgaggactggtgcttacc gccagctcttccaccctgagcagcttatcagtggcaaggaggatgcagcc aacaacttcgcccgtggtcattacaccattggcaaggagattgttgatct gtgccttgaccgtatcaggaagctttcagacaactgcactggtctccagg gattccttgtattcaacgctgttggaggtggaactggctctggccttggc tcgcttctcctggagcgcctctctgttgactatggaaagaagtcc
Download
page-top