Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whvs_17086_l24f
Length 630 bp
Fasta Format > whvs_17086_l24f
TCGCTCGCCCGACGCGATGGCTCCCACCAAGAAGGCGAAGAAGAGCGGGG AGAACATCAACAACAAGCTGCAGCTGGTGATGAAGAGCGGCAAGTACACG CTCGGCTACAAGACCGTCCTCAAGACGCTGCGCAGCTCCAAGGGGAAGCT GATCATCCTCGCGAACAACTGCCCTCCCCTTAGGAAGTCAGAGATTGAGT ACTACGCTATGTTGGCGAAAATTAGCGTGCACCACTTCCACGGAAACAAT GTTGATCTTGGAACTGCCTGCGGCAAGTACTACCGGGTGTGCTGCCTCAG CATCCTTGACCCTGGTGACTCGGACATCATCAGCACCACCACCACCACCC AGTGAAGAGAAGAGAGCTTTCTACCTATTTTATTTAGTCGAGTTGTAGGG TCCTGTTGTGCTCTTGGAACCACTCTTGTTATCTTCGGTTTGTGTACCTT TTTGCGACGCTGAGTTGGAGCTGTCATACAGATAATACTTCATATGGTTG TTCTGCTGGACATTCATGTGGTTTTGTTTTCATGATATCGTTGTTTCCAT CTTGCTGTTGTTTGCTAAGTGTTTTTTGATTCACACAAATCTATGATTCT ATTCACATGAATCATTTTCTAAAAAAAAAA
Download
page-top