Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ278217
Length 660 bp
Fasta Format > whr15e06
gcggcggtgcccgagnggagaagcacggcgacctagcccgagctcgcaac catggctaggggtttgaagaagcatctgaagaggctcaatgccccgtctc actggatgcttgacaagcttggtggagcttttgcccccaagccatcatct ggtcctcacaaggccagggagtgcctgcctctgatcctcatcctgaggaa cagactgaaatatgctctcacctaccgtgaagtgcaatctatccttatgc agcgtcatatcatggttgatggaaaggtccgcactgacaagacctaccct gctgggttcatggacatcatttccattcccaagactggtgagaactacag gcttctttatgacaccaagggtcgcttccgccttcactctgtcagggatg aggatgctaagttcaagctctgcaaggtcaggtctgtccagttcggccag aagggcatcccctacctgaacacctatgatggccgcaccatccgctaccc agacccactcatcaaggccaatgacaccatcaagctcgacctggagacca acaagattgttgacttcatcaagtttgacgtcggcaatgtggtcatggtt actggtgggcgcaacactgggcgtgttggtgtgatcaagaacagggagaa gcataaggga
Download
page-top