Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277801
Length 562 bp
Fasta Format > whr13c06
ttcggcacgaggaagccccgacgctcaagncccccagnacgccgcagcgc cgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgca tctccaaggggaggaagggtagcaaaaagaaggccgtcgatccgttcacc aagaagcagtggtatgacatcaaggcgccgctgctgttcaccagccgcaa cgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag agggtctgaagcacagggtgttcgaagtatctctagctgatcttcagaac gatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgca agggatgaatgtcctcacaaacttctggggcatggacttcaccactgaca agctcaggtctcttgtgaggaagtggcagacactcattgaggctcatgtg gatgtgaagaccactgacaactacatgctccgcatgttcaccattggctt cacgaagagacgcccaaaccaggtgaagcgcacttgctatgcccaagcaa gtcagatcagac
Download
page-top