Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277737
Length 552 bp
Fasta Format > whr12n02
ttcggcacgagggtcccttctagnanagccccttganagtcgcctgtagc ttccccgatcccgcccgatccccaatctccgacgacggcgatgccggccg gacgagagatgggagaggtgtgtggagatctgtaaatagcaggtctagga ttagatcgagtcttgcccaagtggtgtctggcgctatgccgtggtggagc gcgccgccggcgcacgcgagctgcgcctggtggctagcgtcggcgtttct gatggttgcggtggcgaggtgctgcgtgcaaccggaggaaatgacggcgg cgactccttcaataagctcgttgtgtttcctgttaaggtggaggcccggc tgctctaccctttcttttcaagccatcgtggtggtggatggaggaagaag gagaggcggcgagctggactttgcagtttgggaaggagctcatcctcaat gggtttgagacgaggcaacggcgcccgcttcggctgtcggcagccggtcc tcaccgtctcgccattgaatatgctggccgaagggcggccctttctcttc ct
Download
page-top