Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277696
Length 466 bp
Fasta Format > whr12k09
gttcgtactcgcctctctccgcgcatcctagccttcgccctcctccttcc ccatttcgccagcggcgcagcccaccaaccacccccacccgccgccatga gggagtgcatctcgatccacatcggccaggccggcatccaggtcgggaac gcgtgctgggagctctactgcctcgagcatggcattcagcctgatggcca gatgcccggtgacaagaccgttgggggaggtgatgatgctttcaacacct tcttcagcgagactggtgctgggaagcatgtcccccgtgctgtctttgta gatctcgagcccactgtgattgatgaggtgaggactggtgcttaccgcca gctcttccaccctgagcagcttatcagtggcaaggaggatgcagccaaca acttcgcccgtggtcattacaccattggcaaggagattgttgatctgtgc cttgaccgtatcagga
Download
page-top