Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277226
Length 515 bp
Fasta Format > whr10h19
aattcggcacgaggcactcctgggggacccggctgctggccgcggcgacg acggcggtgctcctcctcatcgccacctgcgccgccgcctccgcgctcga cgccttccacgtcccctccgtcgaagcccaagcccacgttacgaagataa atcgattccacaaacagatcaatgggaatgacaaggtgaccttgaccttc agtctatctgcaaatttggaatcacttttcacgtggaacacaaagcaggt ctttgcctttgtgacggcggagtatgaaaccgcaaagaattccctgaacc aggtttcattatgggacaagataatacctgacaaagaggaggcaaatgtc caagtggaggtgaagagcaagtatcccctgactgaccaggggaccagtct gcggggcaagaaagttcagcttgtcctccactggcacatcatgccaaacg ccggcgcaatgatccgaggcaagatgcctctctcggagttcactctccca gacacctatacttcc
Download
page-top