Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277225
Length 648 bp
Fasta Format > whr10h16
gcctcgccgccgccgccactccgccgccgccgccgccgagatgggtcgcg tgatccgcgctcagcgtaagggtgcgggctccgtcttcaagtcccacacc caccaccgcaagggccccgcccgcttcaggtcgctcgacttcggcgagcg caacgggtacctcaagggcgtcgtcaccgatgtcatccacgacccggggc gtggtgcgccgctggccaaggtgaccttccgccacccgttcaggtacaag caccagaaggagctcttcgtcgccgccgagggtatgtacaccggccagtt cgtctactgcggacgccgcgccaccctctccgttggtaacgtcctcccgc tccgctccgtgcctgagggaggcgtcatctgcaacgtcgagcaccacgtc ggcgaccgtggtgtcttcgccagggcctccggtgactacgccatcgtcat cagccacaaccctgacaacggcacctcaaggatcaagctcccctctggtg ccaagaagattgtcccaagcagctgccgtgccatgattggtcaggttgct ggtggtggcaggactgagaagccaatgctcaaggctggtaacgcctacca caagtaccgcgtgaagaggaactcctggcctaaggtgcgtggtgtggc
Download
page-top