Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277224
Length 573 bp
Fasta Format > whr10h15
ccggcaactctcccgcactccggctcggtagcctttccctttccccgttc ggttggtccaagcgctcgcgctcctggctagctggttggctggatctagc cggccagaaccctaacctaacccggcgggtctccaatcctgtccgcatgg agccggccgccaacggcgacaagccctccgacgagcagcagcagttcgat cccagccggatgattggcgtcatcaaaaggaaggccttgattaaagacct agccgctgcttaccacgctgagtgtgtagcatgttgtaaagagcttctgg aactccagaggaagtgggaggaggagcaatgtgtcgaagctaagatgccc gaagtgccaaaaccatcttcgacgaagccttctaagcgcaggaagaggta gatctaccaggggattaatcgatgctgcagtttacttcagtgggggaaat gggaagagaaaagaaaagactcatgtaaacatagttgacctcctgataca caggaaggcgtggtgaaaaactctactgagattcgtggtcttcaaaatgt ggcacgagctagtaaaaaagttt
Download
page-top