Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277223
Length 560 bp
Fasta Format > whr10h12
gaggaattcggacgaggccgaccccgatctncnatcccccggaaccgaaa ccctagccgcggcggcggcggcgatgggcaacccggagaagctgatggcg cagatcttcgacctcaagttcacgtccaagtcgctgcagcggcaggcgcg caagtgcgagaaggaggagaaggagcagaagctcaaggtgaagaaggcca tcgagaagggcaacgtggacggcgcccggatctacgccgagaacgccatc cgcaagcgcaccgagcacatgaactacctccgcctcgcctcccgcctcga cgccgtcgtcgcgcgcctcgacacgcaggccaagatgcaggccatcggca agtccatgggcagcatcgtcaagtcgctcgactcctccctcgccacgggc aacctccagaagatgtccgagaccatggacagcttcgagcgccagttcgt caacatggaggtccaggccgagttcatggagggcgccatggccggctcca cctccctctccacgcccgagaccgaggtcaactccctcatgcagcaggtc gccgacgact
Download
page-top