Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277200
Length 665 bp
Fasta Format > whr10f16
gaattcggacgagggaagagnacatggagccggtcgtgaaggtgtacggg ccagccatgtcttggaacatagccagggtccttgtgagcctggaagagtc cggcgtcaagtacgagctcgtcgccgtcgacttcgccgcggccgagcaca agagccccgcccaccttgctaggaacccattcggtcaggtcccagttttg aaggacggtgacttttgcctctgggagtcacgcgcaatcacgaaatatat atgccgaaagtacaaacctgagctccttggggttggcaatctcgagggat cagcaatggtcgatgtgtggctggaggtggaggcccaccactaccgtcct ctcatagaggctgttcttatggagatcaggatccggccgattttcgggca aagggttgatgagagggccgttgaggagaacattgacaagctgaagaagg tgttggatgtgtatgagtccagattgtcgagctccaagtacctagctgga gatttcatcagcctcgccgacctcaaccacgtctccaccatgctttgcct agggatcactatatacacatcggtgctcgacatgtacccgcatgtaaggg cctggtgggatgacctgaagggcaggccagcggcgaggaaggtgtcggat ctaatgcacatgtcc
Download
page-top