Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277195
Length 653 bp
Fasta Format > whr10f09
gcacccgtgcctcctcttcctcctcgctctctcgcgcacggggctcgcgt ccgaaaccctaacctcccaccatggcggctgaaggcggtggcgtccgggc gctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtcc acctcggcaccaagaactgcgacttccagatggagcgctacgtctacaag cgccgcactgacggcatttacatcatcaaccttggcaagacctgggagaa gcttcagatggccgcaagggtcattgttgccattgaaaaccctcaggata tcattgtgcaatctgctaggccctatggacagagggctgtcctcaagttt gcccagtacactggtgctaacgccattgctggaaggcacactcctggtac attcaccaaccagatgcagacttcattcagtgagccacgccttcttatcc tgaccgaccccaggactgatcaccagcctatcaaggagtctgcacttgga aacatccccaccattgccttctgcgacactgactctcctatgcgttacgt tgatattggcattcctgctaacaacaaggggaagcagagcattggttgcc tattttggctgctcgccaggatggttctgcagatgcgtggtaccattctc cca
Download
page-top