Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277177
Length 554 bp
Fasta Format > whr10d10
ggccccccaccctaccgctcgcgctcgcgacgacgagacagacaagcgcg gacagagccaaggaaacggagtgaaacatgggctctttcctgtcgtcctt gtggacccctcccccgctccccggcgacgaccccgactccgccgtcgtcg ccgtccactccaagcccgcctgggacaagcactgggaggaacaccggaac gcctccaagctgatggtcatcgatttctccgcctcctggtgcgggccctg ccgcttcatcgagcccgccttcaaggagatggcctcccgcttcgccgacg cgctcttcgtcaagatcgacgtcgacgagctcgcggaggttgcaaagaca ttccgcgtagaggcgatgccgacctttgtactggtgaagggcgggcagga ggtgagtcgcgtggtcggggctaagaaggatgagcttgacaggaagatca agacgttcatctcatctacctgatcctagcttaattaacctgcactccaa ttgtagtgccaggttctgtcttgttgatcccagtgtcaaggggctcctat ggtt
Download
page-top