Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277159
Length 515 bp
Fasta Format > whr10c01
tcccgctaaccttcctcgccgtcggatgcgaccgcggcgtccccaatggc gtcctcctccgccgccgagccaggggcccgcctctccgatcggacgagga ggtcgcccctgggcctgagggctatggtgctcctgatgcacgtggtcttc gtcggcgccgtcttcctgctcgattcgaccctcgataggcggatccacga ggagccgtggtatattggagtgtatggtgtgctcgttctgatcgccttag cgcaatacttctacactgctggttcatctccaggctatgttattgatgca atgcaagccagtggtgggatgcatgcaaccttcatcaatactgctactct ttcaaaacaatctagttcaaaacatggaagcttaaagtcctgcacaaacc ggcctgatctagagaaacttagaccaatgtcttcttcatcgtcatggttg catcaaattgtggatctttatcctcctgggtcaagcaacagggattggac ttgccaatattgcaa
Download
page-top