Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277157
Length 562 bp
Fasta Format > whr10b22
tctctactcactcctgtgcctgaggtacctagaaggcacgaaaaatggct gcccagaacaaggaggtggatgccctggtccaaaagatcaccggactcca cgccgccatcgccaagctgccgtcgctcagcccgtccccggacgtcgacg cgctcttcaccgagctggtcaccgcgtgcgttccaccaagccccgtggac gtgaccaagcttggcccggaggcacagaaaatgcgggagggactcatccg cctctgctccgaggccgaggggaagctggaggcgcactactccgacatgc tcgcggccttcgacaacccgctcgaccacctcggcatgttcccctactac aacaactacatcaacctcagcaagctcgagtacgagctcctggcgcgcta cgtgcccggcggcatcgccccggcccgcgtcgccttcatcggctctggcc cactgccgttcagctctttcgtccttgccgcacgccacttgcccgacacc atgttcgacaactacgacctctgtggcgcggccaatgaccgcgccagcaa gctgttccgcgc
Download
page-top