Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277152
Length 664 bp
Fasta Format > whr10b11
accctaaacctcctcgcaaaaaggaagcagctttcgagtttcgcccccaa attcgctcgatcggaagcgaccccgtcggaagcagcaatggcggggctgt ccctgcggtgcggcgactgcggcgtgcagctgaggagcgtggaggaggcg caggcgcacgccgaggccacctcccacaccaacttcgccgagtccaccga ggccgtcctcaacctcgtctgcgccgactgcggcaagccatgccgctctc agaccgaggtggacctgcacaagaagcgcacgggacacgccgagttcacg gacaagaccatggaggcggccaagcccatcgatcttgaggcgccgcccaa gccggcctccgaggccatggatgtggacgcgtccgggagcgcggagccgc aagagttggtgtcgccagaggtgaacaaggagatgctcggggaactcgaa tcgatgggcttttcgactgcgcgtgccactagggcacttcacttctccgg taatagcaccattgaaggcgccattaactggctctctgagcatcaggagg atccggatattgatgaaatgcctatggtgccggccaacaccgtggctaac aagccctctctaactgaggaagagaagaagattaaggcacaagagctgag ggaccgtgctcgta
Download
page-top