Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277149
Length 353 bp
Fasta Format > whr10b06
agaagttttggagnaccaaggaccctgggcagcagccattctctttaaca ttggtctcggttcagtaataaaggatgggatgagggagtcatgggcatgc aattgggtgaagtcgcccgtcttacgtgcaccccagactacgcttatgga tccggtggctttccagcctggggaattcaaccaaactccgtgctgatatt cgagatcgaagttcttagcgccaagtgatgcgcaatgcgattcatgatgg atctatagaacactgcagcatcgccatgcctctcgattaccaaaataatt gtaacgccacttcatgttaagtgccacattatggtgatgttccaaaaaaa aaa
Download
page-top