Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277143
Length 361 bp
Fasta Format > whr10a21
ggtnggctggatgacgccgggtccggtccnaccccggtcctcggggttgg tgcgcgttctcggcgggggcgctcgacggccggcgaggcatgcttgtcta cggcggcaactcgccgacgaacgaccggcttggtgacatgttcctcttca ctccgcttctagcttgagtcagcacgccagctaggcggtgcccgcagctc tgtgtgcaattggagtgggtttgcgacgaacttgctgctttgttaatgtt gtgtgtcatagtagatgatttgcatcttgtgtttatgttgtgtatgtaat aaatgaagaataatagtactcgtagtagtaatgatgaattgggtgtttta caaaaaaaaaa
Download
page-top