Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277141
Length 398 bp
Fasta Format > whr10a19
aaccctttccccttccgatgggcgagcggctcgccggcgccgagaaagag gtgctcgtggagattgtgaggttcacccagaagaacggcctgaagggggc cgaggggggatggaaggatttcctggctctgaacgacaagaagttcggcg cctccgtcagcgaccccaagaagcggaccaaggacgtgctgctcgcgttc ctcgtaaccttctccaaagattttcagaagtactttcgcaaattggtgag gcgtcacgctgaacggagagctatcgagcagtatatgaatgagttttccg gcaagatttctccggagcagaagcttgttcagttgacgacagagcacctt gactacaggaaaaactactacttcccatcttatcaagaggggtggaaa
Download
page-top