Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277134
Length 510 bp
Fasta Format > whr10a09
gctgggacctgtccgaggggaagaggctgtaccagctggaagccggctcc atcatccatgcgctctgcttctcgcccaaccgctactggctctgcgctgc gacagaggagtctgtcaagatctgggacctcgagtccaagcatgtcgtgc aggacctcaagccagaagtgcaggtctccaagaaccagatgctgtactgc acaagcttgagctggagcgcggacggaagcaccctctacaccggatacac cgacgggaccatcagggtcttcaagatccaagccgggttcgccggatacg cgtaggggtcttgctggccagagaggttgtaatgcccgtcaagtttttga ctgttctgaggcaacattgtctgcctggtactttcagcttgagttactgt ttactttctgcttaggtgatttgttgatgagcacattatgaggtactatg gaagacgatctgtttcgcaccagggtttttgctgctttcaatatactgcc aaaaaaaaaa
Download
page-top