Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ277129
Length 514 bp
Fasta Format > whr10a01
ggagaacggcacggcgcccatccccaacctgatnaggagagcaggtcgtt cccgctgtaccgcttcgtccgcgaggagctcggctgcgtgtacctcaccg gcgagaagctgctgtcccccggcgaggagtgcaccaaggtcttcctgggc atcagccagaacaagctcatcgaccccatgctggagtgcctcaaggagtg gaacggcgagcccctgcccatcaacgtctgaagcatcgccggggccaccg tggaggagaggaggaggaggcttccagagtacatccaaaaataagacgct taattcgttcgtgcatgttcttcttcttcaattcctgtcgccttttgcct ttcgttgttcgtgcgttggtgttgatcgacgtgtggcgttgttgttgatt gtgtagctgctctgccatggcggccccgcagctttacctaaagatattgt cgttgtattttggggtgaatcatgctaatactatgtggcttcttttttgc ttgtaaaaaaaaaa
Download
page-top