Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whvh_6063_a13f
Length 723 bp
Fasta Format > whvh_6063_a13f
GCCCGCCGCCGCCTCCTCTCGGTTCCTTCTCCTTCCTCGGAGCTTCAGCC ATGGGTAAAGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGA CTCTGGCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTA TTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGCCGAGATGAAC AAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCG TGAGAGGGGTATCACCATTGATATTGCCCTGTGGAAGTTCGAGACCACCA AGTACTACTGCACCGTCATTGATGCTCCTGGTCACCGTGACTTCATCAAG AACATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTGCTCATCATTGA CTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCC GTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGC TGCTGTAACAAGATGGACGCCACCACTCCCAAGTACTCAAAGGCCCGTTA TGAGGAAATTGTCAAGGAAGTCTCTTCGTACCTGAAGAAGGTCGGCTACA ACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTTGAGGGTGACAAC ATGATTGAGANNTCCACCAACCTTGACTGGTACAAGGGCCCTACCCTTCT TGAGGCTCTTGACCAGATCAACG
Download
page-top