Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ275483
Length 583 bp
Fasta Format > rwhoh7p05
ggaccgagngnacagcaacnaattgcatgatcgacagatacaatgaatga aactacaacccgaccgtgctaccatagcactactagtatccatcgagagg cctttgcaggcacgctgcaacactcgtggaacacatacatatatatctaa attactaaaaccagggtaggaaaacatgcatatgattacattgcgaacca ccactctatcttcttcttgtcatggatgtgccgttgccgcaggggcagtg gcagtggcagccttggtaccgcaaaagatggacgggcagtggatcttagg cacgggcctccagattattccggttattgttggcttctcatccgatactc gaggcttatccacatcagcacggtggccgccggcgtcgcccttggcaggc gcatgaacaaatggagccaaggccgttgctgtggacacgggagtgtctcg agcctagcgtgcgctggcctgaaagcaccactagcagcagggagcaaagg ccgagcaagaagacgtaggagcaggacctggaacccatcgggtgatctga gcagaaagtgctggctcgctcgttgctttgagc
Download
page-top