Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ275397
Length 471 bp
Fasta Format > rwhoh7h16
atgatatattaggcaatggatgatagttcagtcacgacatcaacagtact ccgatgttgtttcacctccagaccccccctcaggctatggcacagaacca tagcctcacaagttctttcacttcttacattttactctagttctaaaggt agcatacgacatagaacagccaggctgcagcaagctccttctaagggcca ggaaagcaccctccggtctggtgaagcatggcgtcgatctcgtcgccttc ctccatctcaagctcatcaggggtctgctcaccacggagcctacgaccat caaaaaggaaagcaatggagttgagatccacagactgacggtcgcagtaa gcgttcatcagcttcttcagctgtgtggatctcttgatgcggaagaaaac ctcattgccatcctgccccttgaccttgaggttgatgtgggcgcctccac cgtcgcccgcgggcttcttgt
Download
page-top