Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ275062
Length 615 bp
Fasta Format > rwhoh5o10
caataatattaggacgcaacagacagcatatctcaagaagtaataacact gaacaaaattccaacaaagatctattcttcacatgatttaacacatgaaa catcatcatatctcataagatccaagctaaacacagagtcttcttcatgg gcaataccaaaacaggacaccttaagcgcagcaacagtcaccgataacaa gcaactaaaaatgtaaagggttcgggtagtaataacggcagagaccgccc tggcgcggccggccggcctagaagcggagcttggtgaagaaccacctgtt cttgccggtcttgaacctctcctcgagcttggccttggcggccttggcgg cgcccaccttcttgtccttggaggtgagggagtcgggcgcgccggaggcc acctccttgaggtcgacgtcgagggtatagcgggtgggcatgagatgggt gaagttgacgagcttgaggaacaccttgacgcgggacttcttggccgtct tcttggccgagtccttgcggatcaccttctttcgggtacttggccagccc ggcgacgaggcagtgcccgtacgggcggtcgcgggtgccctcctcgaaca cgcgcacgatcaccg
Download
page-top