Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ272104
Length 282 bp
Fasta Format > rwhoh3c06
ataagatcaagctaaacacagagtcttcttcatgggcaataccaaaacag gacaccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgta aagggttcgggtagtaataacggcagagaccgccctggcgcggccggccg gcctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaa cctctcctcgagcttggccttggcggccttggcggcgcccaccttcttgt ccttggaggtgagggagtcgggcgcgccggag
Download
page-top