Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208701
Length 630 bp
Fasta Format > wh10g09
ttcggcacgagggctccctcctctcctcgcgcgcagggcccggcgaaagg gaagcaagatgtacaccgccaggaagaagatccagaaggacaagggcgtc gagccctccgagttcgaggacaccgtcgcgcaggctttctttgacctgga gaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaaca ctgcaatccagatggatgttgttggcaacaggaaggccgtggtgatccat gtgccgtaccgtctgcgcaagcccttcaggaagatccatgtcaggctcgt cagggagctggagaagaagtttagcggcaaggatgtggtctttgttgcaa caagaaggattgtgaggccacccaagaagggttctgctgttcagcgccct cgcaccaggaccctgacagctgttcatgatggtatcttggaggatgtcgt gtacccagctgagattgtggggaagcgtgtcagataccgtttggatggtg ccaaggtcatcaagatctacttggacccaaaggagcgcaacaacactgaa tacaagctggagaccttctctgcagtctaccgcaggctttgtgggaaaga cgttgtctttgagtaccctgtgactgaaac
Download
page-top