Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ275995
Length 652 bp
Fasta Format > rwhoh23j16
atgatttaacacatgaaacatcatcatatctcataagatccaagctaaac acagagtcttcttcatgggcaataccaaaacaggacaccttaagcgcagc aacagtcaccgataacaagcaactaaaaatgtaaagggttcgggtagtaa taacggcagagaccgccctggcgcggccggccggcctagaagcggagctt ggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttgg ccttggcggccttggcggcgcccaccttcttgtccttggaggtgagggag tcgggcgcgccggaggccacctccttgaggtcgacgtcgagggtatagcg ggtgggcatgagatgggtgaagttgacgagcttgaggaacaccttgacgc gggacttcttggccgtcttcttggccgagtccttgcggatcaccttcttc gggtacttggccagcccggcgacgaggcagtgcccgtacgggcggtcgcg ggtgccctcctcgaacacgcgcacgatcaccgccttcttccccgcgtacc tgccctgcagcaggatcaccgccttgccgggcttcaggaacttcaccatc ttcgcttccttcctcaagctgcgctgcgccgccgccggtgggttggggga gg
Download
page-top