Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ274142
Length 657 bp
Fasta Format > rwhoh20n20
caggacacacaacaaactgaaaattacaaagcagtccctgaaatatgcag aaaggaccccaaagatctgaagaggaacgcaatcaggtccaagccactcc cgatcgactccaaactcgccggctccggggacatcaccacttggtccgac gagttcttcaccgcagcaagccatgaacatcgatctagagtagcactgcc tcccatatagcttcaaggctaggaggaagaggtttggccgcccttcggcc agaggattcggtggcgcggcggcgctgcaagccggctgtccgccgggagc gccaaagctcaagcaccatcgatgatttgctctggaaccggtcgcaagaa cagtcttcataccagtccctgtcgacttgaccaccaccatggtgactgcc gtcggcgagagcaagcgaaggggattcctgcataccaggggagacatcga gcttatttccgaggattccagcgcgcctgcttccagcagcagcgagccaa ccgccaccaccaacaagagcatcgccaggaaccaccgaacgcggctcggg cgcgccgacagcaaaatcctcatcggcatgacgccaatctccggcactag gccaaactcctctaaggaaaaactagaactacacctactagatactatag agcaccg
Download
page-top