Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ276630
Length 542 bp
Fasta Format > rwhoh1k22
taggacacagtatgtaaaaggcacaagacagacgaccaccaagggcacga tatgcagcgctaacagctgaacagctaaaatataccagtacgaacaatgc ccttaacaaaactcagccaatactaaaaactgcttggtgtctgaacagtg atttggatatcaatgtcgaattacttcttcttgatggcagccttggtcac cttggccccggttgggtccttcttctcgacgcccttgatgacaccaacag ccacagtctgcctcatgtcacggacagcaaaacgaccaagaggcgggtaa gtggcaaaggtctccacaaccatgggcttggtgggaatcatcttcactat gccagcatcaccattcttgaggaacttgggcgcggcctctatctccttac cagatcgcctgtcaatcttggtcaccagctcagcaaacttgacagcaatg tgcgaggtgtggcagtccagcactggggcgtagccgttgccaatctgacc agggtggttcatgatgatgacctgggaggtgaagttggctgc
Download
page-top