Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ276577
Length 610 bp
Fasta Format > rwhoh1h10
ataagatcnagctaacacagagtcttcttcatgggcaataccaaaacagg acaccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgtaa agggttcgggtagtaataacggcagagaccgccctggcgcggccggccgg cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaac ctctcctcgagcttggccttggcggccttggcggcgcccaccttcttgtc cttggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcga cgtcgagggtatagcgggtgggcatgagatgggtgaagttgacgagcttg aggaacaccttgacgcgggacttcttggccgtcttcttggccgagtcctt gcggatcaccttcttcgggtacttggccagcccggcgacgaggcagtgcc cgtacgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgcc ttcttccccgcgtacctgccctgcagcaggatcaccgccttgccgggctt caggaacttcaccatcttcgcttccttcctcaagctgcgctgcgccgccg ccggtgggtt
Download
page-top