Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ216616
Length 517 bp
Fasta Format > rwh13b12
ttatttatcntatacgacaaaaggttcacaccacaattcatgcacccttg cttgcaccagaacacgcacataacacccacacacacaagccaggcaaggg acagtccacgcagagtgcacgcttgcgacaaccagagcacatcaaggctc gaattattccaacctagacagggcctactgctgcccatcactaccgacac aatgggggtgggtcgggtctccaagcggcgggagggcttacgggttcact ttcggcgcccacccggcgatcaggttctccttggtcgccttggtcttgac gaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtca gggtttcagggaccttccagcccttgaagtgctccagggcgacctggagg tggtagagcttnggagccaggctgagatcgacggcggagatgttcgcccc gttgatgtagggtccatgggccttcaggtgctcttcgagtgcctgcagct cgtcaacaagtgccttc
Download
page-top