Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whsp_5032_a08f
Length 555 bp
Fasta Format > whsp_5032_a08f
GCGAGCTCTGTCGGTTCTCTATCTAGCATCTCCGGTGTGAAGCGAGCAAG CAGAGAGAGAGAGATGGCGTCCACTCGTCGCATGGCTGCCGCGCCGGCCG TCCTCCTTCTCCTCCTCCTGCTCGTCGCCACAGAGATGGGGACGATGAAG ACGGCGGAGGCCCGGACGTGCCTGTCGCAGAGCCACAAGTTCAAGGGCAC CTGCCTCAGCAACAGCAACTGCGCCGCCGTGTGCCGCACCGAGAACTTCC CCGACGGCGAGTGCAACACGCACCTCGTCGAGCGCAAGTGCTACTGCAAG CGGACCTGCTAAGCAACACCAGTCCGCGCGACGTCCTCCGGTGGATGCTT GCTACTGGGCTAGAGCATCCATGCCGTCCCTTAGATCTGTTCGTCCCTAC TCCGTCTATTTCCATTTCCTTTACGTTGCTCCTAGGGATGACTGAAAATA AAGTAGCTACCTGCACCCTCGGCATTGGCTGTTCGTCTGCATGTATGCTG TTTAAGTGTTCGTGGCTTTAGTTTGTGCTGTTGATGTAATAACGATGCCA CTGAC
Download
page-top