Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ272791
Length 599 bp
Fasta Format > rwhoh13k03
acattaagagtagccacgtagcatttttcaaaagacatggatacagcccc ggcgccatacgggcaaaaatcagcttcatcgataacaccgccaaaacccc aaagagcgggcaggcatcttgatcttgggtcccaaaaaagcttgctgccc aacctatcttactgttgtgcgcactgcactctttgggcaccgcctccagg catctcgtcgtcctcatcgtacgcctcctgagcagcagcatgggctttcc gacgcatctcctcctccatgttgacgtcatgcattgtcgtctcctcgcat tcatcgagctccatgtcggtcagcttggatgcaggctttggtggaagcac agcctcgagagccttgcactgatccggtgccagcgagtcgggaaactcca ccgtgaaatgaatgtagagcttgcccttcatgaaaggcctctggtacatc ggcatcccctcgtcgctgattgccttgaatgaatcaggcttgacaacttc accagggtttgatttaatgagcagctgcctgttgtccagatgggtcagga cgagttggaacccacaaagagcttcagtgagagatatggtatgctcata
Download
page-top